In conclusion two novel series of furo pyrimidin amines and

In conclusion, two novel series of furo[2,3-]pyrimidin4-amines and 7-pyrrolo[2,3-]pyrimidin-4-amines which exhibit potent in vitro inhibitor activity against ACK1 have been identified and evaluated. 1,3-Dithiolane-substituted pyrrolopyrimidine displays excellent ACK1 cellular inhibition, good kinase selectivity, and a suitable in vitro metabolic profile. Unfortunately, the pharmacokinetic profile of was poor and prevented this inhibitor from being further evaluated in tumor xenograft studies.
Cell division and subsequent differentiation are highly organized processes that are regulated by members of the cyclin dependent kinase family , . Cyclin–cyclin-dependent kinase (CDK) complexes can regulate Sodium Aescinate progression positively or negatively , , and the activity and specificity of a CDK depends on its association with cyclins and other regulatory proteins , . Plants with reduced levels of CDK activity are altered in cell division and growth . CDKs exert their effects by phosphorylating serine/threonine residues on specific substrates involved in signal transduction pathways . CDK inhibitors (ICKs) are low molecular-weight proteins that bind to cyclin–CDK complexes and also act as assembly factors for CDKs and cyclins , , . The cell cycle is an integral part of plant growth and development , , and is regulated by CDKs . The role of the cell cycle is being approached in many studies of the conserved mechanisms controlling cell division and development , . These mechanisms depend on interactions between intrinsic developmental programs and environmental signals and require proper control of the cell division cycle , . It is likely that signals intrinsic to plant growth and development are integrated through a variety of pathways and channeled into the regulation of cell proliferation and differentiation. The present study addresses the link between cell division, morphogenesis and plant growth by investigating the functions of a plant CDK inhibitor. We report the characterization of an gene by overexpressing it in . The results provide evidence of how is involved in plant growth and development. Materials and methods Plant materials. Plants of Arabidopsis thaliana (L.) Heynh (ecotype Columbia) were grown either in soil or in MS medium, at a constant temperature of 22°C under 16/8h day/night cycle. cDNA clone and transformation. The ACK1 cDNA was identified in a yeast two-hybrid screen, as described previously [19]. The primers used were based on sequence information (Accession No: AF106705) and the ACK1 cDNA was amplified from total RNA using the ThermoScript RT-PCR system (Life Technologies). The plasmid contained ACK1 gene introduced into Agrobacterium tumefaciens strain LBA4404 and used to transform Arabidopsis plants by vacuum infiltration [20]. Seeds (T1) from infiltrated plants were harvested and selected on MS medium containing 50mg/L kanamycin. The resulting kanamycin-resistant plants were transferred to soil in pots and grown in chambers. RT-PCR analysis. Total RNA was isolated with Trizol (Gibco-BRL) according to the manufacturer’s instructions and used for RT-PCR with forward primer: 5′GAGAAAAGACTTGTTCGATGGTTCTCATA3′ and reverse primer: 5′TGAATTGCTTCTTCTTATCGTCTTGACTC3′. RT reaction mixtures (20μl) contained 5U AMV reverse transcriptase (Life Sciences), 20U RNase inhibitor, 5mM MgCl2, 2μl of 10× RNA PCR buffer, 4mM dNTPs, 1μg total RNA, and 1μM of random primer, and were incubated for 30min at 50°C. For synthesis of the first strand cDNA, 50μl reaction mixtures contained 3μl of 25mM MgCl2, 4μl of 10×PCR buffer, 2.5U Taq DNA polymerase, and 1μl RT mixture. The PCR protocol consisted of 30 cycles of 92°C for 1min, 42°C for 30s, and 72°C for 1min 30s, followed by extension at 72°C for 7min. Ten microliter samples of the PCR products were analyzed by agarose gel electrophoresis and stained by ethidium bromide. Immunoblotting. Proteins were resolved by SDS–PAGE and transferred to nitrocellulose membranes. The blots were blocked with 5% milk in TBS-T and probed with anti-ACK1 antibody followed by HRP-conjugated α-Ig secondary antibody (Amersham).